TY - JOUR
T1 - Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat
AU - Yu, Sui
AU - Mangelsdorf, Marie
AU - Hewett, Duncan
AU - Hobson, Lynne
AU - Baker, Elizabeth
AU - Eyre, Helen J.
AU - Lapsys, Naras
AU - Le Paslier, Denis
AU - Doggett, Norman A.
AU - Sutherland, Grant R.
AU - Richards, Robert I.
N1 - Funding Information:
Correspondence should be addressed to S. Y. or R. I. R. (e-mail: [email protected]). This work was supported in part by grants from the National Health and Medical Research Council (Australia) and the Adelaide Children's Hospital Research Foundation. G.R.S. is an International Research Scholar of the Howard Hughes Medical Institute; D.H. is the recipient of a Wellcome Trust Prize Travelling Research Fellowship. We thank Shirley Richardson, Annette Orsborn, Sharon Lane, Julie Nancarrow, Tony Triglia, Sinoula Apostolou, David Callen, John Mulley, and Brian Reid for technical assistance, discussions, and comments on drafts of this manuscript. R.I.R. thanks Shelley Richards for support and encouragement during the course of these studies and dedicates his contribution to the memory of Ken Little.
PY - 1997/2/7
Y1 - 1997/2/7
N2 - Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A- sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
AB - Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A- sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
UR - https://www.scopus.com/pages/publications/0030974861
U2 - 10.1016/S0092-8674(00)81875-9
DO - 10.1016/S0092-8674(00)81875-9
M3 - Article
C2 - 9039263
AN - SCOPUS:0030974861
SN - 0092-8674
VL - 88
SP - 367
EP - 374
JO - Cell
JF - Cell
IS - 3
ER -