Skip to main navigation Skip to search Skip to main content

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

  • Sui Yu
  • , Marie Mangelsdorf
  • , Duncan Hewett
  • , Lynne Hobson
  • , Elizabeth Baker
  • , Helen J. Eyre
  • , Naras Lapsys
  • , Denis Le Paslier
  • , Norman A. Doggett
  • , Grant R. Sutherland
  • , Robert I. Richards

Research output: Contribution to journalArticlepeer-review

Abstract

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A- sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Original languageEnglish
Pages (from-to)367-374
Number of pages8
JournalCell
Volume88
Issue number3
DOIs
Publication statusPublished or Issued - 7 Feb 1997
Externally publishedYes

ASJC Scopus subject areas

  • General Biochemistry,Genetics and Molecular Biology

Cite this